Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0008450 | |||
Gene | CMTM3 | Organism | Human |
Genome Locus | chr16:66642211-66643906:+ | Build | hg19 |
Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
DBLink | Link to database | PMID | 30018710 |
Experimental Method | |||
Sample Type | Tissues and Cell lines | Comparison | Seventy-eight pairs of HCC tissues and corresponding adjacent normal tissues were acquired from patients underwent surgical operation |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GGACTCTGCAGATGAGACCA ReverseAAGTACAAGGCCAGCAGGAAC | Statistics | Fold Change : Upregulation,8.45 pvalue : p=0.000000628 |
Citation | |||
Cai, H, Hu, B, Ji, L, Ruan, X, Zheng, Z (2018). Hsa_circ_0103809 promotes cell proliferation and inhibits apoptosis in hepatocellular carcinoma by targeting miR-490-5p/SOX2 signaling pathway. Am J Transl Res, 10, 6:1690-1702. |